Skip to main content
Download PDF

A rare haplotype of the GJD3 gene segregating in familial Meniere’s disease interferes with connexin assembly

Genome Medicine volume 17, Article number: 4 (2025) Cite this article

Abstract

Background

Familial Meniere’s disease (FMD) is a rare polygenic disorder of the inner ear. Mutations in the connexin gene family, which encodes gap junction proteins, can also cause hearing loss, but their role in FMD is largely unknown.

Methods

We retrieved exome sequencing data from 94 individuals in 70 Meniere's disease (MD) families. Through gene burden analysis, we calculated the enrichment of rare variants (allele frequency < 0.05) in connexins genes in FMD individuals compared with the reference population. The connexin monomer and the homomeric connexon structural models were predicted using AlphaFold2 and HDOCK. RT-qPCR and immunofluorescence were done in mice cochleae to identify expression of the mouse ortholog candidate gene Gjd3.

Results

We found an enrichment of rare missense variants in the GJD3 gene when comparing allelic frequencies in FMD (N = 94) with the Spanish reference population (OR = 3.9[1.92–7.91], FDR = 2.36E-03). In the GJD3 sequence, we identified a rare haplotype (TGAGT) composed of two missense, two synonymous, and one downstream variant. This haplotype was found in five individuals with FMD, segregating in three unrelated families with a total of ten individuals; and in another eight MD individuals. GJD3 encodes the gap junction protein delta 3, also known as human connexin 31.9 (Cx31.9). The protein model predicted that the NP_689343.3:p.(His175Tyr) missense variant could modify the interaction between connexins and the connexon assembly, affecting the homotypic GJD3 gap junction between cells. Our studies in mice revealed that Gjd3—encoding Gjd3 or mouse connexin 30.2 (Cx30.2)—was expressed in the organ of Corti and vestibular organs, particularly in the tectorial membrane, the base of inner and outer hair cells and the nerve fibers.

Conclusions

The present results describe a novel association between GJD3 and FMD, providing evidence that FMD is related to changes in the inner ear channels, and supporting a new role of tectorial membrane proteins in MD.

Background

Connexins are essential plasma membrane proteins in epithelial intercellular junctions [1]. Connexin protein subunits form a hexameric complex named connexon, and each connexon forms a hemichannel in the plasma membrane. The arrangement of two connexons between adjacent cells forms a gap junction, which communicates the cytoplasm of both cells and controls the intercellular exchange of small molecules, metabolites, and ions [2, 3]. In the inner ear, gap junctions are essential in maintaining the fluid’s homeostasis. They are located in the organ of Corti and the lateral wall of the cochlea, including the stria vascularis [2, 4, 5].

The tectorial membrane (TM) is an extracellular matrix located along the length of the organ of Corti, where the lateral surface is attached to the stereocilia of the mechanosensory hair cells. It intercedes in the deflection of the stereocilia, being involved in the hair cell stimulation and, therefore, in the gating of channels [6, 7].

Meniere’s disease (MD, MIM: 156,000) is an inner ear disorder characterized by episodic vertigo and associated with sensorineural hearing loss (SNHL), tinnitus, and/or aural fullness [8]. The criteria to diagnose MD are based on the clinical symptoms occurring during the attacks of vertigo and the documentation of SNHL by pure tone audiogram before, during, or after the episode of vertigo. Several subgroups of patients with MD have been reported according to associated co-morbidities [9], such as migraine or autoimmune disorders, cytokine profile [10], or methylation signature [11].

The syndrome shows familial aggregation and several rare variants in different genes have been reported in singular families, manifesting a considerable genetic heterogeneity [12]. Furthermore, exome sequencing in additional families with MD supports a burden of rare variation in three central SNHL genes in familial MD (FMD), including OTOG (MIM: 604,487) [13], MYO7A (MIM: 276,903) [14], and TECTA (MIM: 602,574) [15].

Furthermore, genetic studies have demonstrated the importance of some connexins expressed in the inner ear for human hearing. GJB2 (MIM: 121,011) mutations lead to approximately half of monogenic non-syndromic SNHL, besides GJB6 (MIM: 604,418) and GJB3 (MIM: 603,324) mutations cause non-syndromic hearing loss (HL) [2, 3]. In this way, Gallego-Martinez et al. [16] found a significant overload of missense variants in GJB2 in sporadic MD (SMD) patients that were not found in the reference population.

We have sequenced and analyzed a large cohort of patients with MD and identified a rare haplotype TGAGT in the gene GJD3 (MIM: 607,425), segregating the phenotype in multiple families, supporting GJD3 as a new gene associated with FMD.

Methods

Patient selection

The human ethics protocol of this study was approved by the Institutional Review Board (Protocol number: 1805-N-20), and all the subjects signed a written informed consent to donate biological samples. The investigation followed the principles of the Declaration of Helsinki revised in 2013 [17].

Patients were diagnosed and recruited within the Meniere’s Disease Consortium (MeDiC) in Spain, according to the diagnostic criteria described by the International Classification Committee for Vestibular Disorders of the Barany Society [18]. A total of 94 FMD patients from Spanish referral centers belonging to 70 different families with one or more first-degree relatives affected by MD were included. In addition, a dataset of 313 patients with SMD was studied. Pure-tone audiograms (125–8000 Hz) were conducted in all the participants within a sound-attenuated booth (Audiometric test booth S40-A, Sibelmed, Barcelona, Spain) to assess hearing loss HL, according to the auditory thresholds determined by the ascending method established in ISO 8253–1 (2020). The plots were represented using tidyr [19], ggplot2 [20], dplyr [21], ggpubr [22], and scales [23] R packages.

Exome sequencing

To perform whole exome sequencing (WES), blood samples were obtained from each patient. DNA samples were extracted using prepIT-L2P (DNA Genotek, Ottawa, Canada) and QIAamp DNA Mini Kit (Qiagen, Venlo, The Netherlands) following the manufacturer’s protocols. The quality controls required for exome sequencing were checked by Nanodrop (Thermo Fisher, Waltham, MA, USA) and Qubit (Invitrogen, Waltham, MA, USA) as previously described [24]. DNA integrity was verified by electrophoresis in a 2% agarose gel, the concentration and the 260/280 ratio were superior to 20 ng/µL and 1.8, respectively. DNA libraries were prepared to select coding regions by using SureSelect Human All Exon V6 capture kit (Agilent Technologies, Santa Clara, CA, USA), utilizing 1 µg of input genomic DNA from each sample, and paired-end sequenced on the Illumina HiSeq 4000 platform with a mean coverage of 100 × .

Dataset generation

Paired-end sequences were mapped to the GRCh38/hg38 human reference genome, using the maximal exact matches algorithm Burrows-Wheeler Aligner (BWA). Nextflow Sarek v2.7.1 workflow, included in nf-core [25], was utilized to perform the exome reference alignment, base quality score recalibration (BSQR), variant calling, and quality filtering. Duplicated reads were removed, and the alignment quality was evaluated [26]. Genetic variants were called using the Haplotypecaller function, from GATK [27]. In this stage, single nucleotide variants (SNVs) and short insertions and deletions (indels) were detected at nucleotide resolution, and the results were saved in a Variant Calling Format (VCF) file for each subject.

The VCF files were normalized with the norm function from bcftools [28]. Each VCF file was filtered according to the criteria followed to create the gnomAD database: Allele balance (AB) ≥ 0.2 and AB ≤ 0.8 (for heterozygous genotypes only), genotype quality (GQ) ≥ 20, and depth (DP) ≥ 10 (5 for haploid genotypes on sex chromosomes) [29]. Using the merge function of bcftools, a MD variant dataset containing the variants of all the individuals was generated [28]. Following GATK best practices, a variant quality filtering was carried out with Variant Score Recalibration (VQSR), which calculates a new quality score: VQSLOD. Variants that accomplished a VQSLOD < 90 were retained.

Variant annotation and prioritization strategy

Variants included in the dataset were annotated using Ensembl Variant Effect Predictor (VEP). Then, variants in connexin genes for SMD and FMD were selected and saved separately for further analyses [3, 30].

Two independent databases were used to retrieve the allelic frequencies (AF) of the variants in three reference populations. The AF for non-Finish European (NFE, n = 32,299) and global population (n = 71,702) were obtained from the gnomAD database v.3.0 [31]. Population-specific AF for the Spanish population were retrieved from the Collaborative Spanish Variant Server (CSVS, n = 2048) [32]. For this, we performed a liftover from GRCh19/hg19 to GRCh38/hg38 reference genomes, which only included SNVs.

To perform the gene burden analysis (GBA), an AF < 0.05 was selected as a threshold in the three databases. Besides, variants were classified according to the consequence in the protein to perform 6 different GBA (missense; frameshift, inframe deletion, and inframe insertion; stop gain; 3′UTR; 5′UTR; and synonymous) for familial patients (Additional file 1: Fig. S1). Only one individual from each family was selected, whenever possible, according to the lowest age of onset and/or from the last generation.

To search genes associated with FMD, a GBA was carried out in familial cases. The aggregated AF for each gene calculated for the three reference populations (gnomAD NFE, gnomAD global, and CSVS) was compared with the aggregated AF in FMD, and odds ratios (OR) with 95% confidence interval (CI) were calculated. Furthermore, two-sided p values were obtained and corrected according to the false discovery rate (FDR) for multiple testing by the total number of variants identified for each gene; and etiological fraction (EF) was calculated, as previously described [33]. Genes with an adjusted p value < 0.05 and OR ≥ 1 in one of the three comparisons with each reference population were considered enriched.

To prioritize those genes obtained as enriched in the GBA, the dataset RNA-Seq in P0 from the murine cochlea to contrast hair cells with the rest of the cochlear duct from the gene Expression Analysis Resource (gEAR) database [34] was used. Genes expressed in the inner ear were selected for further analysis. Variants in selected genes were assessed by the Combined Annotation Dependent Depletion (CADD) [35] score and following the standards and guidelines described by the American College of Medical Genetics and Genomics (ACMG) and the Association for Molecular Pathology (AMP) [36].

Visual inspection confirmed candidate variants in BAM files to rule out false positives. Moreover, the variants g.40363293G > A, g.40363579G > T, and g.40363294C > G in GJD3 were validated by Sanger sequencing, using the following primers: CCACCGCGAAATAGAAGAGC (Fw) and AGGACGAGCAAGAGGAGTTC (Rv).

The constraint metrics were obtained from the gnomAD database v.2.1.1 [31]. The ratio of the observed/expected missense variants and the Z score were calculated with the deviation of observed from the expected were considered in this study. A Z score is calculated by the ratio between observed variation and expected depletion of variation at a 1-kb scale.

Linkage disequilibrium and haplotype

The complete list of GJD3 variants was downloaded from the gnomAD database v.3.1.2 [31] to calculate the linkage disequilibrium (LD) among all known variants in GJD3. The R2 score was obtained and represented for each pair of variants, using the LDmatrix and LDheatmap function from the LDlinkR [37] and LDheatmap [38] R packages, respectively. Besides, the LDhap function from the LDlinkR R package was used to calculate the haplotype frequencies of shared variants in the global (ALL), European (EUR), and Iberian in Spain (IBS) populations. Population genotype data used in LDlinkR was obtained from Phase 3 (Version 5) of the 1000 Genomes Project.

Computational protein modeling

The connexin 31.9 (Cx31.9) amino acid sequence was retrieved from Uniprot (Q8N144). The monomer structural model was predicted using AlphaFold2 [39]. The structural model of the homomeric connexon, with a C6 symmetry, and the homotypic gap junction (two connexons) was predicted using HDOCK [40]. HDOCK does not use the entire protein in the docking process, focusing on predicting the conformation of the binding sites of the protein to reduce the computational cost. The quality of the protein structural models was assessed using the structure validation algorithms Molprobity [41], Verify3D [42], ERRAT [43], ProSA-web [44], and QMEANDisCo [45]. The mutated Cx31.9 protein was modeled by comparative homology modeling with MODELLER 10.4 [46] using the wild-type Cx31.9 protein model as a template. These in-silico models were used to predict the protein stability change (ΔΔG) caused by the candidate variants, using the ENCoM [47], DynaMut2 [48], I-Mutant [49], mCSM [50], mCSM-membrane [51], mmCSM-PPI [52], SDM [53], and PremPS [54] tools. Variants were classified as neutral when − 0.5 < ΔΔGpred < 0.5 [55].

The Cx31.9 structural model is accessible on the ModelArchive database: www.modelarchive.org/doi/https://doiorg.publicaciones.saludcastillayleon.es/10.5452/ma-bwdwf.

Mouse husbandry

The animal experiments were approved by the Governmental Ethics Commission for Animal Welfare in Berlin, Germany (LaGeSo Berlin, Germany; approval number: T 0235/18) and by the Dirección General de Agricultura, Ganadería y Alimentación in Comunidad de Madrid, Spain (approval number PROEX 325.4/21).

Neonatal mice were kept in a standard cage with their mother and siblings until the day of the experiment. At three to five days of age (P3-P5), mice are blind and deaf, which drastically reduces their sensory perception of the environment. Pups were individually euthanized by decapitation (in accordance with the German Animal Welfare Act) within 30 min of arrival at the laboratory. Adult mice of 1, 3, 6, and 12 months of age were housed with ad libitum access to food (regular rodent chow and water) and maintained on a 12 h light/dark cycle. Euthanasia was performed by pentobarbiturate overdose (Dolethal, Vetoquinol, Spain; 150 mg/kg; IP).

Mouse cochlear RNA isolation and quantitative RT-PCR

Cochlear samples from C57BL/6JCrl mice of 1, 6, and 12 months of age were obtained and processed as reported [56, 57]. Immediately after dissection, cochleae were frozen in RNAlater® solution (Ambion, Foster City, CA, USA). Cochlear RNA was extracted using the RNeasy Plus Mini kit (Qiagen, Hilden, Germany) automated on the Qiacube (Qiagen, Hilden, Germany). RNA integrity was assessed with an Agilent 2100 bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). cDNA was generated from pooled cochlear RNA extracts (each pool included three cochleae from different animals per age group) by reverse transcription with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosynthesis, Thermo Fisher Scientific) and amplified in triplicate by real-time quantitative PCR (RT-qPCR) in a QuantStudio 7 Flex PCR System (Applied Biosystems, Foster City, CA, USA) using gene-specific primers (Fw: CGCACACGGTCGACTGTTT, Rv: GCGAAGTAGAAGACCACGAAGAC). Data was collected after each amplification step and analyzed with QuantStudio™ Real-Time PCR software 1.3 (Applied Biosystems). Hprt1 (hypoxanthine phosphoribosyltransferase 1) and Tbp (TATA-Box Binding Protein) genes were used as housekeeping genes for normalization. Differences between ages were calculated by the Student’s t-test with ΔCt values (Ct target gene − Ct value reference gene), and the Fold Change (FC) and Standard error of the mean (SEM) were obtained following the 2−ΔΔCT method. Outliers were identified by the interquartile range (IQR) method filtering those values 1.5 IQR below the first quartile or 1.5 IQR above the third quartile. The statistics and visualizations were performed using ggplot2 [20] and ggpubr [22] R packages.

Mouse cochlear Immunohistofluorescence

Cochlear and vestibular samples from postnatal day 3 to 5 (P3–5), cochlear samples from postnatal day 30 (P30), and cochlear samples from postnatal day 90 (P90) C57BL/6JCrl mice were obtained and processed following standard protocols, as reported [56, 57]. Briefly, adult mice were perfused with 4% paraformaldehyde in PBS. Dissected inner ears were post‐fixed with 4% paraformaldehyde, decalcified in 5% EDTA, cryopreserved with sucrose, and embedded in a medium for cryotomy. For immunostaining, cryostat cross Sects. (10 μm) were firstly dried at room temperature and then washed with PBS 0.1 M. After that, specimens were incubated for 1 h in a normal goat serum solution in a humidified chamber at room temperature to block nonspecific binding sites. Then the specimens were incubated for 24 h with primary antibody (rabbit polyclonal anti-connexin 30.2, LifeTechnologies, # 40–7400) diluted (1:125) in goat serum/PBS/Triton X-100 at 4 °C in a humidified chamber. On the following day, after 4 × 15 min of washing, specimens were incubated with the specific fluorophore-conjugated antibody (Alexa Fluor 488 Goat Anti-Rabbit IgG (H + L), LifeTechnologies, # A11034) diluted (1:400) in goat serum/PBS/Triton X-100 for 1.5 h at room temperature in a humidified chamber. Finally, the specimens were coverslipped using ProLong® Gold Antifade Reagent with DAPI (Cell Signaling Technologies, Danvers, MA, USA, # 8961). The fluorescent images of stained cryosections from P90 mice were taken with an epifluorescence microscope (Nikon 90i, Tokyo, Japan); and from P3–5 and P30 mice with a Leica SPE confocal microscope. The confocal images were merged in a z-stack using ImageJ [58].

Functional validation in Xenopus laevis oocytes

Human Cx31.9 wild-type (WT), NP_689343.3:p.(His175Tyr) and NP_689343.3:p.(Arg253Pro) complementary DNAs (cDNAs) cloned between NheI and BamHI sites in a modified pCDNA3.1( +) vector containing 5′ and 3′-Xenopus globin UTR and a polyadenylation signal, were generated using custom gene synthesis with codon optimization for Homo sapiens (GenScript). For expression in Xenopus laevis oocytes, plasmid DNAs were linearized with BamHI restriction enzyme, from which capped RNAs were synthesized using the T7 mMessage mMachine Kit (Invitrogen).

Oocyte extraction from Xenopus laevis frogs was performed following a protocol approved by the Animal Ethics Committee of The University of Sydney (AEC No. 2016/970) in accordance with the National Health and Medical Research Council of Australia code for the care and use of animals. Ovarian lobes were sliced into small pieces using surgical knives and defolliculated by collagenase treatment. Healthy-looking stage V-VI oocytes were injected with 50 nL of a 0.5 ng/nL RNA and incubated at 18 °C in modified Barth’s solution (96 mM NaCl, 2.0 mM KCl, 1 mM MgCl2, 1.8 mM CaCl2, 5 mM HEPES, 2.5 mM sodium pyruvate, 0.5 mM theophylline, and 100 μg/mL gentamicin; pH 7.4). Two to 3 days after RNA injection, two-electrode voltage-clamp measurements were performed on oocytes continuously perfused in recording solution mimicking the endolymph (100 mM KCl, 2 NaCl, 1.8 mM BaCl2, 5 mM HEPES; pH 7.4) at room temperature using an Axon GeneClamp 500B amplifier (Molecular Devices, LLC, Sunnyvale, CA, USA). Data were acquired using the pCLAMP 10 software (Molecular Devices) and a Digidata 1440A digitizer (Molecular Devices), sampled at 10 kHz. Recording microelectrodes with resistances around 0.2–1.0 MΩ were pulled from borosilicate glass capillaries (Harvard Apparatus) using a PC-100 Dual-Stage Glass Micropipette Puller (Narishige) and were filled with 3 M KCl.

Results

Overload of missense variants in the GJD3 gene in familial cases

A total of 71 variants in 19 connexin genes with an AF < 0.05 were retained to carry out a GBA in FMD individuals (Table 1, Additional file 1: Fig. S1 and Table S1). Variants were classified according to the consequence in the protein, the most common being missense variants. We found an enrichment of missense variants in the GJD3 gene when comparing the AF in FMD against the Spanish population from CSVS (OR = 3.9 [1.92–7.91], FDR = 2.36E–03, EF = 0.74). Moreover, an enrichment of synonymous variants in the GJD3 gene comparing the AF in the FMD against the Spanish population from CSVS (OR = 3.46 [1.89–6.33], FDR = 5.76E–04, EF = 0.71), and also the global population from gnomAD (OR = 2.9 [1.63–5.14], FDR = 3.02E–03, EF = 0.65).

Table 1 Connexin genes with enrichment of rare variants (allelic frequency (AF) < 0.05) in familial Meniere’s disease (FMD)
Full size table

Segregation of a rare haplotype in the GJD3 gene with FMD

We found several rare variants in the GJD3 gene in FMD (all of them with the accession NC_000017.11): two missense variants (g.40363058C > G, g.40363293G > A) an inframe deletion (g.40363099_40363101del), two downstream variants (g.40356228C > T, g.40356584C > A) and four synonymous variants (g.40363294C > G, g.40363327G > A, g.40363528G > A, g.40363579G > T) (Table 2). Interestingly, five of these variants, g.40356228C > T (downstream), g.40363058C > G (missense), g.40363293G > A (missense), g.40363294C > G (synonymous), and g.40363579G > T (synonymous) were shared among five patients with FMD and were segregated in three families, with a total of ten individuals carrying a haplotype with the five variants. Moreover, this haplotype was found in another eight individuals with non-familial MD that were initially considered as sporadic cases. However, four of them have relatives with incomplete MD phenotype (HL or episodic vestibular symptoms). The variants g.40363293G > A, g.40363294C > G and g.40363579G > T were validated by Sanger sequencing (Additional file 1: Fig. S2).

Table 2 Variants in GJD3 connexin gene found in familial Meniere’s disease (FMD) cases
Full size table

The LD study showed a strong correlation between the four shared coding variants. The linkage between g.40363293G > A, g.40363294C > G, and g.40363579G > T was complete (R2 = 1), and LD between each of them with g.40363058C > G was almost complete (R2 = 0.966) (Additional file 1: Fig. S3).

Since these five variants (g.40356228C > T, g.40363058C > G, g.40363293G > A, g.40363294C > G and g.40363579G > T) seem to form a haplotype (TGAGT), we study the AF in the 1000 Genomes Project population: 0.0058 for the global population, 0.0159 for the European and 0.0093 for the Iberian in Spain (Additional file 1: Table S2). Besides, in the 1000 Genome Project, we found the haplotype CGGCG, present only in one individual in the population of 1,000 Genomes Project, originally from Spain (AF global = 0.0002, AF European = 0.001, AF Iberian in Spain = 0.0047). This CGGCG haplotype had the reference allele for all the variants except for the g.40363058C > G missense variant. This genotype has been shown in another three non-familial MD individuals of our cohort (Table 2, Additional file 1: Table S2).

The constraint of the GJD3 gene for missense variants—according to gnomAD—is determined by the Z score = 0.76, and the ratio observed/expect = 0.78 (0.64–0.95). The ratio of less than 1 and the positive Z score value suggest that the gene is highly conserved and intolerant to variation.

Characterization of individuals carrying GJD3 variants

A detailed clinical characterization of the hearing profile was performed for the 18 individuals with the TGAGT rare haplotype. From the five familial probands, the segregation in three of those families was confirmed (families F1, F2, and F3); however, it was not possible to obtain blood samples from relatives of two probands (F4 and F5).

The proband (III-6) of family 1 (F1) was a 53-year-old woman with definite MD. Her mother (II-5) was also diagnosed with definite MD with Tumarkin crisis, both carrying the variants studied. Moreover, an uncle of the proband (II-1) was diagnosed with probable MD and he did not have the same variants. His clinical history differs from the other two cases, as his age of onset for MD was 73, relatively older than that of the proband and her mother, which was 33 and 66, respectively. Moreover, his flat hearing profile does not show a drop in high frequencies (Fig. 1A).

Fig. 1
figure 1

Pedigrees of families 1–3 and their corresponding air conduction audiogram. dB, decibels; kHz, kilohertz

Full size image

In family 2 (F2), the proband (III-13) was a 62-year-old woman with definite MD. Her mother (II-5) also suffered from MD, and four of her five siblings and two aunts have vertigo attacks. Besides, one of her two uncles presented HL, and his daughter (III-7), cousin of the proband (III-13), was also diagnosed with definite MD. They all started with episodic symptoms at a similar age at 42, 49, and 45 years old, respectively (Fig. 1B). The three cases with MD have the studied variants. Nevertheless, it was not possible to obtain samples for the individuals with incomplete phenotypes.

The proband (II-4) of the third family (F3) was a 70-year-old man with definite MD. His father (I-1) was also diagnosed with definite MD, whereas his brother (II-3) had probable MD based on the audiometry results. In this family, all these three individuals carry the variants of interest, and they have a similar age of onset—being 40, 42, and 37, respectively. Furthermore, none of his children suffer from inner ear disorders, but his granddaughter (IV-1) has presented high-frequency HL since her birth. Neither IV-1 nor her parents (III-3 and III-4) were carriers of the studied variants (Fig. 1C).

The case in F4 was a 79-year-old woman with definite MD, bilateral HL (Additional file 1: Fig. S4), with an onset at 31 years old and a history of migraine and autoimmune diseases (hypothyroidism, monoclonal gammopathy, positive rheumatoid factor). The F5 case was a woman with definite MD, with bilateral HL, and her age at HL onset was 22 years.

In addition, four (S1, S2, S3, and S4) of the eight SMD cases with the studied variants have first-degree relatives with vertigo and SNHL or only episodic vertigo. Interestingly, the three SMD cases (S9, S10, and S11) with the CGGCG haplotype did not report relatives with HL or vestibular disorders (Additional file 1: Fig. S4).

Protein modeling

The monomeric structure of the Gap junction delta-3 protein (Q8N144)—called GJD3 and Cx31.9—encoded by the GJD3 gene, was predicted using AlphaFold2. Furthermore, both the hexameric connexon in a closed conformation, with a C6 symmetry, and the structure of the homotypic Cx31.9 channel, formed by two identical connexons along a two-fold crystallographic symmetry axis, were modeled (Fig. 2). Based on the geometrical validation results, reliable models have been built compared to structures solved by experimental methods at the geometrical level (Additional file 1: Table S3). These models were used to predict the impact of the variants found on the stability of the monomer, connexon, and gap junction models.

Fig. 2
figure 2

Model of the human Cx31.9 gap junction formed by two homomeric connexons; and change produced by the NP_689343.3:p.(His175Tyr) variant comparing the wild-type protein with the mutated

Full size image

The NP_689343.3:p.(His175Tyr), NP_689343.3:p.(Pro248del), and NP_689343.3:p.(Arg253Pro) variants were predicted in-silico as neutral (− 0.5 < ΔΔGpred < 0.5) according to the predicted change in global Cx31.9 monomer stability for the majority of methods used (Additional file 1: Table S4). The effect on protein stability of the NP_689343.3:p.(His175Tyr) and NP_689343.3:p.(Arg253Pro) variants, found together in the same patients, have also been predicted to be neutral.

In the homomeric connexon and the homotypic gap junction models, the NP_689343.3:p.(His175Tyr) variant was predicted to have a stabilizing effect on the structure of the complex (Additional file 1: Table S5). Nevertheless, based on the model and the interaction between the two connexons, the replacement of the histidine by tyrosine would affect the formation of the channel, since the electrostatic interaction between histidine 175 and aspartic 178 would be lost and replaced by the larger and uncharged amino acid tyrosine. Therefore, it could potentially alter the interaction between both connexons (Fig. 2).

Cx30.2 expression and cellular localization in mouse inner ear

Immunofluorescence in the inner ear of young and adult mice was used to examine the localization of the Gap junction delta-3 protein (Gjd3, Q91YD1)—also known as connexin 30.2 (Cx30.2)—encoded by Gjd3, which is an orthologue of the GJD3 human gene.

Firstly, in the P3 young mouse cochleae, a strong immunofluorescence labeling of Cx30.2 was observed in the TM; furthermore, Cx30.2 was expressed in the hair cells from the organ of Corti and cartilage (Fig. 3A–C). In P30 adult mouse cochleae, expression was predominantly observed in the TM (Fig. 3D–F). Finally, immunofluorescence labeling of Cx30.2 in P90 adult mouse inner ear showed dispersed punctiform labeling in the cochlea, localized at the spiral limbus, TM, nerve fibers, and organ of Corti; especially below the basal pole of inner hair cells (Fig. 3G–H). In addition, the expression of Gjd3 in both the entire cochlea and in the dissected TM was validated via western blot analysis (Additional file 1: Methods S1.1, Fig. S5).

Fig. 3
figure 3

Expression of connexin 30.2 (Cx30.2)—encoded by the mouse Gjd3 gene—(B, C, E, F, and H) and controls without primary antibody (A, D, and G) at the cochlea in mouse inner ear sections, and expression of Cx30.2 in mouse development (I). A–C: In postnatal day 3 (P3) mice, the immunofluorescence revealed strong expression of Cx30.2 at the tectorial membrane (TM), and also in a punctiform labeling at the cartilage and inner hair cells (IHC); not observed in the negative control. D-F: The punctiform immunofluorescence labeling of Cx30.2 in postnatal day 30 (P30) cochlea was observed especially at the TM, when comparing against the negative control. G-H: In postnatal day 90 (P90), Cx30.2 appears in the cochlea in a very dispersed punctiform immunofluorescence labeling at spiral limbus (SL), nerve fibers region (NF) and TM; with more dense patches at TM or below the IHC; not observed in the negative control. I: Gene expression (ΔCt) of Gjd3 in 1, 6, and 12-month-old mouse cochleae (in each age group, there are four pools, each consisting of three cochleae). Student’s t-test was used to calculate the p value in each comparison. The Cx30.2 is stained using the rabbit polyclonal anti-connexin 30.2, LifeTechnologies, # 40–7400 (green), and the nuclei are stained using DAPI (blue). Scale bars 100 μm (A, B, D, and E) and 50 μm (C, F, G, and H). SV, stria vascularis; BM, basilar membrane; OHC, outer hair cells; SC, supporting cells

Full size image

However, slight immunofluorescence labeling was observed at the P90 macula (Fig. S6A–C), and no signal was identified in the maculae and crista ampullaris in P4-P5 mice (Additional file 1: Fig. S6D–I).

Gjd3 expression in the adult mouse cochlea was also confirmed by RT-qPCR in 1-, 6- and 12-month-old individuals. Significant differences were found in Gjd3 expression levels between 1- and 6-month-old animals (p = 0.011), with a lower ΔCt value (higher expression) in 1-month-old compared to 6-month-old mice (FC ± SEM = 0.610 ± 0.057). Although expression was higher in 1-month-old mice than in 12-month-old (FC ± SEM = 0.747 ± 0.111), that difference was not statistically significant (p = 0.073, Fig. 3I).

Functional characterization of human Cx31.9 in Xenopus laevis oocytes

To examine the functional properties of human Cx31.9 hemichannels, we expressed the Cx31.9 in Xenopus laevis oocytes, and measured currents in response to a wide range of voltage steps (+ 80 to − 100 mV) from a holding potential of − 40 mV. Consistent with the functional expression of hemichannels, Xenopus oocytes injected with Cx31.9 WT RNA showed significantly larger currents at + 80 mV and − 100 mV compared to uninjected oocytes (p < 0.0001, n = 33 for WT, n = 28 for uninjected; Fig. 4). The NP_689343.3:p.(His175Tyr) variant showed WT-level current amplitudes at + 80 mV (WT: 856 ± 275 µA, n = 33; H175Y: 845 ± 290 µA, n = 28; p = 0.88) and − 100 mV (WT: − 382 ± 112 µA, n = 33; H175Y: − 366 ± 99 µA, n = 28; p = 0.79). The NP_689343.3:p.(Arg253Pro) variant, on the other hand, showed a slight increase in current amplitudes compared to WT at + 80 mV (R253P: 1007 ± 406 µA, n = 40, p = 0.065) and at − 100 mV (R253P: − 453 ± 141 µA, n = 40, p = 0.0092).

Fig. 4
figure 4

Functional expression of human Cx31.9 hemichannels in Xenopus laevis oocytes. A Representative current traces of Xenopus oocytes that are untreated (not injected with RNA) and expressing Cx31.9 wild-type, NP_689343.3:p.(His175Tyr) and NP_689343.3:p.(Arg253Pro) hemichannels in response to a voltage-step protocol from + 80 mV to − 100 mV (holding potential =  − 40 mV). B Current amplitudes elicited at + 80 mV and − 100 mV. Floating bars show the third quartile, median (middle line), and first quartile values. WT: wild-type; H175Y: NP_689343.3:p.(His175Tyr); R253P: NP_689343.3:p.(Arg253Pro); ns: p < 0.05; **: p ≤ 0.01; ****: p ≤ 0.0001; Student’s t-test

Full size image

Discussion

The main finding in this work is the burden of rare variants in the human GJD3 connexin gene, encoding the GJD3 protein (also named Cx31.9) in FMD. By manual inspection and segregation analyses of these variants, our study has identified a rare TGAGT haplotype in the gene GJD3 that segregates the complete phenotype in multiple unrelated families with MD and supports an association of GJD3 with FMD. Furthermore, immunofluorescence experiments reveal the presence of Gjd3 protein (also named Cx30.2) in mice cochleae and vestibules; and, unexpectedly, Cx30.2 has been localized for the first time in the TM.

A haplotype consisting of two missense, two synonymous, and one downstream variant segregate with a dominant pattern in three different families with some individuals affected by MD; in addition, in another two familial cases and eight sporadic individuals, four of them had first-degree relatives with incomplete phenotype. The 18 MD cases shared the same haplotype TGAGT for the variants: g.40356228C > T, g.40363058C > G, g.40363293G > A, g.40363294C > G and g.40363579G > T; whose frequency in the Iberian population in Spain is 0.0093. The low frequency of the haplotype and the segregation in non-related families leads to the association with the disease. The most interesting variant is g.40363293G > A, NP_689343.3:p.(His175Tyr) at the protein level, which produces an amino acid change from a positively charged histidine to a bulky and hydrophobic tyrosine in the extracellular extreme of the connexon. This replacement would produce the loss of the electrostatic interactions that occur between histidine 175 and aspartic 178 in each of the six connexins conforming the homomeric connexon, altering the correct arrangement between two connexons to form the channel. Although the electrophysiological characterization of WT and the mutated NP_689343.3:p.(His175Tyr) Cx31.9 hemichannels in Xenopus laevis oocytes demonstrated no differences in the current amplitudes (Fig. 4B); the amino acid change could modify the interaction between both connexons, leading to decreased formation of homotypic gap junction channels. Likewise, Schadzek et al. [59] demonstrated that a missense variant in an extracellular loop (as in our case) of Cx46—encoded by GJA3—is related to an autosomal dominant zonular pulverulent cataract. In this case, they demonstrated that the mutated connexin affected the co-expressed WT connexin to achieve a dominant inheritance. The heterodimer mutated-WT made less gap junction plaques than the homodimer WT-WT, and the homodimer mutated-mutated formed almost none.

In addition, different studies have demonstrated the importance of Gjd3 in the correct impulse propagation in the cardiac conduction system tissues [60, 61], being related to diseases such as chronic venous disease [62]. It has been demonstrated that Gjd3 can form heterotypic channels with other three connexins in mice heart cells [63, 64]. We suspect that, in the same way, Gjd3 could form heteromeric connexons and heterotypic channels in the cochlea with the other connexins expressed, as it has been demonstrated with Cx26, Cx30, and Cx31—also named Gjb2, Gjb6, and Gjb3, respectively. Heteromeric Gjb2/Gjb6 channels have been found connecting cochlear supporting cells, and the Gjb2 and Gjb3 also form heteromeric Gjb2/Gjb3 connexons and homomeric/heterotypic Gjb2/Gjb3 gap junctions [65,66,67]. The correct arrangement of a heterotypic connexon also would be affected by the g.40363293G > A variant. Nevertheless, it cannot be asserted that the expression of human GJD3 is identical to that of mouse Gjd3 in the cochlea, as observed in the heart [68].

It is currently not possible to model the mutant hemichannel NP_689343.3:p.(Arg253Pro) as the residue is located in the highly flexible cytoplasmic region, which also remains unresolved in other connexin structural studies [69]. Therefore, we used an electrophysiological assay to assess the potential functional impact of this variant. Electrophysiological characterization of the mutated NP_689343.3:p.(Arg253Pro) Cx31.9 hemichannel in Xenopus laevis oocytes showed that at hyperpolarized potentials, the current amplitudes were significantly larger than the WT hemichannels (Fig. 4B). As the increase in current amplitudes was small and the functional significance of the cytoplasmic region of connexins is currently poorly understood, we refrain from drawing any conclusion about this finding. Future studies investigating the effect of this variant in gap junction channels will help clarify the pathogenicity of this variant.

Hearing relies on the displacements of the stereocilia of hair cells provoked by sound. The membrane depolarization entails fluxes of Ca2+ and K+ into the cell, leading to the excitation of the auditory nerve [70, 71]. As evidenced in prior research, inner ear connexins are essential in the Ca2+ signaling [72]. Besides, there are Ca2+-rich filamentous structures in the TM that are involved in the connection of the TM and the hair cell stereocilia, which assure the mechanical stimulation and the obtention of Ca2+ by the hair cells [71]. Our immunofluorescence data confirm the expression of Gjd3 in the mouse TM and we speculate that GJD3 could be related to the function of those filamentous ducts. Moreover, regarding the cycling transport of K+, the K+ flows through the hair cells from the endolymph to the perilymph [73]. The TM is sealed, therefore to arrive at the hair cells from the endolymph, the K+ must cross the TM [74]. We hypothesize that GJD3 may contribute to maintaining the local ionic microenvironment driving K+ fluxes to the tip of stereocilia. When the K+ arrives to the hair cells, it reaches to the perilymph through scala tympani, then to the spiral ligament, and arrives to the stria vascularis, where it is returned to the endolymph. It has been studied that the GJB2, GJB3, and GJB6 connexins are crucial in this transport [4, 66, 73]. Because of that, we propose that GJD3, which we found expressed some of these cells and structures, should be involved in the K+ cycle.

Furthermore, the connexins Gjb2, Gjb6, and Gja1 have been found in the mammalian vestibular system [75]. Our immunofluorescence data in the vestibular organs confirm labeling of Gjd3 below the macular epithelium; however, further studies with higher resolution are needed to confirm these observations.

By exome sequencing and familial analysis, different genes have been found associated with MD. Particularly, an enrichment of rare missense variants in 15 unrelated MD families, with six of them showing compound heterozygous recessive inheritance in OTOG, and rare missense variants and two short deletions were identified in four different MD families in TECTA genes, respectively; both genes encode non-collagenous proteins of the TM [13, 15]. Moreover, the other nine unrelated families presented rare variants in the MYO7A gene, expressed in the stereocilia of the hair cells in the sensory epithelia [14]. Taken together, these studies and the findings in GJD3, suggest that the proteins involved in the architecture of the stereocilia links and the attachment of the stereocilia tips to the TM could be involved in the pathophysiology of MD.

In the present work, the type of inheritance observed in the TGAGT rare haplotype in GJD3 in three MD families was autosomal dominant. Three different inheritance modes have been reported in FMD: autosomal dominant, autosomal recessive, and digenic inheritance. These outcomes describe a complex inheritance, that coupled with specific environmental factors, could lead to a variation of phenotype, including the HL profile, and age of onset, even in the same family [76]. Moreover, epigenetic modifications could probably shape clinical manifestations. By whole-genome bisulfite sequencing (WGBS), CpGs in ADGRV1 (MIM: 602,851), CDH23 (MIM: 605,516), and PCDH15 (MIM: 605,514) were determined as differentially methylated when comparing MD against healthy controls. Those genes encode for stereocilia link proteins, which are involved in attaching the hair cells to the TM [11].

Furthermore, in the three non-familial cases with the CGGCG haplotype (displaying the reference alleles except for the g.40363058C > G missense variant), the variant alone would not explain the phenotype. However, it is very interesting for future work opening the possibility to study the complete genome to identify regulatory variants in GJD3, as in the promoters or in the 5′ or 3′ untranslated regions (UTRs); and/or study in combination with the genetics with epigenetics in sporadic cases.

Limitations

This study was limited to coding sequences, and whole genome sequencing data will be needed to study non-coding regions and its relationship with the disease. Also, the lack of clinical records and DNA samples of some participants makes it difficult to segregate the haplotype in some individuals. Moreover, functional studies will be necessary to understand the function and the consequences of the missense variants in the human Cx31.9 protein in the inner ear, and additional immunological studies to confirm the weak signals in the vestibule.

Conclusions

This study revealed a rare haplotype in the gene GJD3 that segregates in several unrelated families with MD. The Cx30.2—encoded by the mouse ortholog Gjd3—was localized in mouse cochlea, including the tectorial membrane. The variants found in the FMD individuals may involve the interactions between two connexons leading to dysfunction in the channels. Finally, in line with previous findings, our results support that the proteins of the tectorial membrane and the stereocilia link could be involved in the molecular pathophysiology of FMD.

Data availability

Additional file 2 contains the genetics data of the connexins genes from the individuals participating in this study. In addition, the described haplotype is at ClinVar under the accession number: SUB14910602.

References

  1. Totland MZ, Rasmussen NL, Knudsen LM, Leithe E. Regulation of gap junction intercellular communication by connexin ubiquitination: physiological and pathophysiological implications. Cell Mol Life Sci. 2020;77(4):573–91. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s00018-019-03285-0.

    Article  CAS  PubMed  Google Scholar 

  2. Mammano F. Inner Ear Connexin Channels: Roles in Development and Maintenance of Cochlear Function. Cold Spring Harb Perspect Med. 2019;9(7):a033233. https://doiorg.publicaciones.saludcastillayleon.es/10.1101/cshperspect.a033233.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  3. Srinivas M, Verselis VK, White TW. Human diseases associated with connexin mutations. Biochim Biophys Acta BBA - Biomembr. 2018;1860(1):192–201. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.bbamem.2017.04.024.

    Article  CAS  Google Scholar 

  4. Hibino H, Kurachi Y. Molecular and Physiological Bases of the K+ Circulation in the Mammalian Inner Ear. Physiology. 2006;21(5):336–45. https://doiorg.publicaciones.saludcastillayleon.es/10.1152/physiol.00023.2006.

    Article  CAS  PubMed  Google Scholar 

  5. Chen P, Wu W, Zhang J, et al. Pathological mechanisms of connexin26-related hearing loss: Potassium recycling, ATP-calcium signaling, or energy supply? Front Mol Neurosci. 2022;15:976388. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fnmol.2022.976388.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  6. Sellon JB, Ghaffari R, Freeman DM. The Tectorial Membrane: Mechanical Properties and Functions. Cold Spring Harb Perspect Med. 2019;9(10):a033514. https://doiorg.publicaciones.saludcastillayleon.es/10.1101/cshperspect.a033514.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  7. Richardson G, Lukashkin A, Russell I. The tectorial membrane: One slice of a complex cochlear sandwich. Curr Opin Otolaryngol Head Neck Surg. 2008;16(5):458–64. https://doiorg.publicaciones.saludcastillayleon.es/10.1097/MOO.0b013e32830e20c4.

    Article  PubMed  PubMed Central  Google Scholar 

  8. Frejo L, Soto-Varela A, Santos-Perez S, et al. Clinical Subgroups in Bilateral Meniere Disease. Front Neurol. 2016;7:182. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fneur.2016.00182.

    Article  PubMed  PubMed Central  Google Scholar 

  9. Frejo L, Martin-Sanz E, Teggi R, et al. Extended phenotype and clinical subgroups in unilateral Meniere disease: A cross-sectional study with cluster analysis. Clin Otolaryngol Off J ENT-UK Off J Neth Soc Oto-Rhino-Laryngol Cervico-Facial Surg. 2017;42(6):1172–80. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/coa.12844.

    Article  CAS  Google Scholar 

  10. Frejo L, Gallego-Martinez A, Requena T, et al. Proinflammatory cytokines and response to molds in mononuclear cells of patients with Meniere disease. Sci Rep. 2018;8(1):5974. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41598-018-23911-4.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. Flook M, Escalera-Balsera A, Gallego-Martinez A, et al. DNA Methylation Signature in Mononuclear Cells and Proinflammatory Cytokines May Define Molecular Subtypes in Sporadic Meniere Disease. Biomedicines. 2021;9(11):1530. https://doiorg.publicaciones.saludcastillayleon.es/10.3390/biomedicines9111530.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  12. Escalera-Balsera A, Roman-Naranjo P, Lopez-Escamez JA. Systematic Review of Sequencing Studies and Gene Expression Profiling in Familial Meniere Disease. Genes. 2020;11(12):1414. https://doiorg.publicaciones.saludcastillayleon.es/10.3390/genes11121414.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. Roman-Naranjo P, Gallego-Martinez A, Soto-Varela A, et al. Burden of Rare Variants in the OTOG Gene in Familial Meniere’s Disease. Ear Hear. 2020;41(6):1598–605. https://doiorg.publicaciones.saludcastillayleon.es/10.1097/AUD.0000000000000878.

    Article  PubMed  Google Scholar 

  14. Roman-Naranjo P, Moleon MDC, Aran I, et al. Rare coding variants involving MYO7A and other genes encoding stereocilia link proteins in familial meniere disease. Hear Res. 2021;409:108329. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.heares.2021.108329.

    Article  CAS  PubMed  Google Scholar 

  15. Roman-Naranjo P, Parra-Perez AM, Escalera-Balsera A, et al. Defective α-tectorin may involve tectorial membrane in familial Meniere disease. Clin Transl Med. 2022;12(6):e829. https://doiorg.publicaciones.saludcastillayleon.es/10.1002/ctm2.829.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  16. Gallego-Martinez A, Requena T, Roman-Naranjo P, Lopez-Escamez JA. Excess of Rare Missense Variants in Hearing Loss Genes in Sporadic Meniere Disease. Front Genet. 2019;10:76. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fgene.2019.00076.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  17. World Medical Association. World Medical Association Declaration of Helsinki: ethical principles for medical research involving human subjects. JAMA. 2013;310(20):2191–4. https://doiorg.publicaciones.saludcastillayleon.es/10.1001/jama.2013.281053.

    Article  CAS  Google Scholar 

  18. Lopez-Escamez JA, Carey J, Chung WH, et al. Diagnostic criteria for Menière’s disease according to the Classification Committee of the Bárány Society. HNO. 2017;65(11). https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s00106-017-0387-z

  19. Wickham H, Girlich M. tidyr: Tidy Messy Data. Published online 2022. https://CRAN.R-project.org/package=tidyr

  20. Wickham H. ggplot2: Elegant Graphics for Data Analysis. Published online 2016. https://ggplot2.tidyverse.org

  21. Wickham H, François R, Henry L, Müller K. dplyr: A Grammar of Data Manipulation. Published online 2022. https://CRAN.R-project.org/package=dplyr

  22. Kassambara A. ggpubr: “ggplot2” Based Publication Ready Plots. Published online 2020. https://CRAN.R-project.org/package=ggpubr

  23. Wickham H, Seidel D. scales: Scale Functions for Visualization. Published online 2022. https://CRAN.R-project.org/package=scales

  24. Szczepek AJ, Frejo L, Vona B, et al. Recommendations on Collecting and Storing Samples for Genetic Studies in Hearing and Tinnitus Research. Ear Hear. 2019;40(2):219–26. https://doiorg.publicaciones.saludcastillayleon.es/10.1097/AUD.0000000000000614.

    Article  PubMed  PubMed Central  Google Scholar 

  25. Garcia M, Juhos S, Larsson M, et al. Sarek: A portable workflow for whole-genome sequencing analysis of germline and somatic variants. F1000Research. 2020;9:63. https://doiorg.publicaciones.saludcastillayleon.es/10.12688/f1000research.16665.2

  26. McKenna A, Hanna M, Banks E, et al. The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 2010;20(9):1297–303. https://doiorg.publicaciones.saludcastillayleon.es/10.1101/gr.107524.110.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  27. Poplin R, Ruano-Rubio V, DePristo MA, et al. Scaling accurate genetic variant discovery to tens of thousands of samples. Published online. 2018:201178. https://doiorg.publicaciones.saludcastillayleon.es/10.1101/201178

  28. Danecek P, Bonfield JK, Liddle J, et al. Twelve years of SAMtools and BCFtools. GigaScience. 2021;10(2):008. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/gigascience/giab008.

    Article  CAS  Google Scholar 

  29. Tiao G, Goodrich J. gnomAD v3.1 New Content, Methods, Annotations, and Data Availability. gnomAD v3.1 New Content, Methods, Annotations, and Data Availability. Published 2020. https://gnomad.broadinstitute.org/news/2020–10-gnomad-v3–1-new-content-methods-annotations-and-data-availability/. Accessed 16 Mar 2023.

  30. GeneCards - Human Genes | Gene Database | Gene Search. Accessed April 12, 2022. https://www.genecards.org/

  31. Karczewski KJ, Francioli LC, Tiao G, et al. The mutational constraint spectrum quantified from variation in 141,456 humans. Nature. 2020;581(7809):434–43. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41586-020-2308-7.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  32. Peña-Chilet M, Roldán G, Perez-Florido J, et al. CSVS, a crowdsourcing database of the Spanish population genetic variability. Nucleic Acids Res. 2021;49(D1):D1130–7. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/nar/gkaa794.

    Article  CAS  PubMed  Google Scholar 

  33. Walsh R, Mazzarotto F, Whiffin N, et al. Quantitative approaches to variant classification increase the yield and precision of genetic testing in Mendelian diseases: the case of hypertrophic cardiomyopathy. Genome Med. 2019;11:5. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13073-019-0616-z.

    Article  PubMed  PubMed Central  Google Scholar 

  34. Cai T, Jen HI, Kang H, Klisch TJ, Zoghbi HY, Groves AK. Characterization of the transcriptome of nascent hair cells and identification of direct targets of the Atoh1 transcription factor. J Neurosci Off J Soc Neurosci. 2015;35(14):5870–83. https://doiorg.publicaciones.saludcastillayleon.es/10.1523/JNEUROSCI.5083-14.2015.

    Article  CAS  Google Scholar 

  35. Kircher M, Witten DM, Jain P, O’Roak BJ, Cooper GM, Shendure J. A general framework for estimating the relative pathogenicity of human genetic variants. Nat Genet. 2014;46(3):310–5. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/ng.2892.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Shearer AE, Eppsteiner RW, Booth KT, et al. Utilizing ethnic-specific differences in minor allele frequency to recategorize reported pathogenic deafness variants. Am J Hum Genet. 2014;95(4):445–53. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.ajhg.2014.09.001.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  37. Myers TA, Chanock SJ, Machiela MJ. LDlinkR: An R Package for Rapidly Calculating Linkage Disequilibrium Statistics in Diverse Populations. Front Genet. 2020;11:157. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fgene.2020.00157.

    Article  PubMed  PubMed Central  Google Scholar 

  38. Shin JH, Blay S, McNeney B, Graham J. LDheatmap: An R Function for Graphical Display of Pairwise Linkage Disequilibria Between Single Nucleotide Polymorphisms. J Stat Softw. 2006;16:1–9. https://doiorg.publicaciones.saludcastillayleon.es/10.18637/jss.v016.c03.

    Article  Google Scholar 

  39. Jumper J, Evans R, Pritzel A, et al. Highly accurate protein structure prediction with AlphaFold. Nature. 2021;596(7873):583–9. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41586-021-03819-2.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  40. Yan Y, Tao H, He J, Huang SY. The HDOCK server for integrated protein–protein docking. Nat Protoc. 2020;15(5):1829–52. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41596-020-0312-x.

    Article  CAS  PubMed  Google Scholar 

  41. Williams CJ, Headd JJ, Moriarty NW, et al. MolProbity: More and better reference data for improved all-atom structure validation: PROTEIN SCIENCE.ORG. Protein Sci. 2018;27(1):293–315. https://doiorg.publicaciones.saludcastillayleon.es/10.1002/pro.3330.

    Article  CAS  PubMed  Google Scholar 

  42. Eisenberg D, Lüthy R, Bowie JU. VERIFY3D: Assessment of protein models with three-dimensional profiles. In: Methods in Enzymology. Vol 277. Elsevier; 1997:396–404. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/S0076-6879(97)77022-8

  43. Colovos C, Yeates TO. Verification of protein structures: Patterns of nonbonded atomic interactions. Protein Sci. 1993;2(9):1511–9. https://doiorg.publicaciones.saludcastillayleon.es/10.1002/pro.5560020916.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  44. Wiederstein M, Sippl MJ. ProSA-web: interactive web service for the recognition of errors in three-dimensional structures of proteins. Nucleic Acids Res. 2007;35(Web Server):W407-W410. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/nar/gkm290

  45. Studer G, Rempfer C, Waterhouse AM, Gumienny R, Haas J, Schwede T. QMEANDisCo—distance constraints applied on model quality estimation. Bioinformatics. 2020;36(8):2647–2647. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/bioinformatics/btaa058.

    Article  PubMed  PubMed Central  Google Scholar 

  46. Fiser A, Šali A. Modeller: Generation and Refinement of Homology-Based Protein Structure Models. In: Methods in Enzymology. Vol 374. Elsevier; 2003:461–491. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/S0076-6879(03)74020-8

  47. Frappier V, Chartier M, Najmanovich RJ. ENCoM server: exploring protein conformational space and the effect of mutations on protein function and stability. Nucleic Acids Res. 2015;43(W1):W395–400. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/nar/gkv343.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  48. Rodrigues CHM, Pires DEV, Ascher DB. DynaMut2: Assessing changes in stability and flexibility upon single and multiple point missense mutations. Protein Sci Publ Protein Soc. 2021;30(1):60–9. https://doiorg.publicaciones.saludcastillayleon.es/10.1002/pro.3942.

    Article  CAS  Google Scholar 

  49. Capriotti E, Fariselli P, Casadio R. I-Mutant2.0: predicting stability changes upon mutation from the protein sequence or structure. Nucleic Acids Res. 2005;33(Web Server issue):W306-W310. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/nar/gki375

  50. Pires DEV, Ascher DB, Blundell TL. mCSM: predicting the effects of mutations in proteins using graph-based signatures. Bioinforma Oxf Engl. 2014;30(3):335–42. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/bioinformatics/btt691.

    Article  CAS  Google Scholar 

  51. Pires DEV, Rodrigues CHM, Ascher DB. mCSM-membrane: predicting the effects of mutations on transmembrane proteins. Nucleic Acids Res. 2020;48(W1):W147–53. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/nar/gkaa416.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  52. Rodrigues CHM, Pires DEV, Ascher DB. mmCSM-PPI: predicting the effects of multiple point mutations on protein–protein interactions. Nucleic Acids Res. 2021;49(W1):W417–24. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/nar/gkab273.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  53. Worth CL, Preissner R, Blundell TL. SDM—a server for predicting effects of mutations on protein stability and malfunction. Nucleic Acids Res. 2011;39(Web Server issue):W215-W222. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/nar/gkr363

  54. Chen Y, Lu H, Zhang N, Zhu Z, Wang S, Li M. PremPS: Predicting the impact of missense mutations on protein stability. PLoS Comput Biol. 2020;16(12):e1008543. https://doiorg.publicaciones.saludcastillayleon.es/10.1371/journal.pcbi.1008543.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  55. Pancotti C, Benevenuta S, Birolo G, et al. Predicting protein stability changes upon single-point mutation: a thorough comparison of the available tools on a new dataset. Brief Bioinform. 2022;23(2):bbab555. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/bib/bbab555.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  56. Celaya AM, Sánchez-Pérez I, Bermúdez-Muñoz JM, et al. Deficit of mitogen-activated protein kinase phosphatase 1 (DUSP1) accelerates progressive hearing loss. eLife. 2019;8:e39159. https://doiorg.publicaciones.saludcastillayleon.es/10.7554/eLife.39159.

    Article  PubMed  PubMed Central  Google Scholar 

  57. Bermúdez-Muñoz JM, Celaya AM, Hijazo-Pechero S, Wang J, Serrano M, Varela-Nieto I. G6PD overexpression protects from oxidative stress and age-related hearing loss. Aging Cell. 2020;19(12):e13275. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/acel.13275.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  58. Schneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nat Methods. 2012;9(7):671–5. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/nmeth.2089.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  59. Schadzek P, Stahl Y, Preller M, Ngezahayo A. Analysis of the dominant mutation N188T of human connexin46 (hCx46) using concatenation and molecular dynamics simulation. FEBS Open Bio. 2019;9(5):840–50. https://doiorg.publicaciones.saludcastillayleon.es/10.1002/2211-5463.12624.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  60. Kreuzberg MM, Söhl G, Kim JS, Verselis VK, Willecke K, Bukauskas FF. Functional properties of mouse connexin30.2 expressed in the conduction system of the heart. Circ Res. 2005;96(11):1169–77. https://doiorg.publicaciones.saludcastillayleon.es/10.1161/01.RES.0000169271.33675.05.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  61. Kreuzberg MM, Schrickel JW, Ghanem A, et al. Connexin30.2 containing gap junction channels decelerate impulse propagation through the atrioventricular node. Proc Natl Acad Sci USA. 2006;103(15):5959–64. https://doiorg.publicaciones.saludcastillayleon.es/10.1073/pnas.0508512103.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  62. Helkkula P, Hassan S, Saarentaus E, et al. Genome-wide association study of varicose veins identifies a protective missense variant in GJD3 enriched in the Finnish population. Commun Biol. 2023;6(1):71. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s42003-022-04285-w.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  63. Gemel J, Lin X, Collins R, Veenstra RD. Beyer EC. Cx30.2 can form heteromeric gap junction channels with other cardiac connexins. Biochem Biophys Res Commun. 2008;369(2):388–94. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.bbrc.2008.02.040.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  64. Rackauskas M, Verselis VK, Bukauskas FF. Permeability of homotypic and heterotypic gap junction channels formed of cardiac connexins mCx30.2, Cx40, Cx43, and Cx45. Am J Physiol Heart Circ Physiol. 2007;293(3):H1729–36. https://doiorg.publicaciones.saludcastillayleon.es/10.1152/ajpheart.00234.2007.

    Article  CAS  PubMed  Google Scholar 

  65. Defourny J, Thiry M. Recent insights into gap junction biogenesis in the cochlea. Dev Dyn Off Publ Am Assoc Anat. 2023;252(2):239–46. https://doiorg.publicaciones.saludcastillayleon.es/10.1002/dvdy.538.

    Article  Google Scholar 

  66. Defourny J, Thelen N, Thiry M. Cochlear connexin 30 homomeric and heteromeric channels exhibit distinct assembly mechanisms. Mech Dev. 2019;155:8–14. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.mod.2018.10.001.

    Article  CAS  PubMed  Google Scholar 

  67. Liu XZ, Yuan Y, Yan D, et al. Digenic inheritance of non-syndromic deafness caused by mutations at the gap junction proteins Cx26 and Cx31. Hum Genet. 2009;125(1):53–62. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s00439-008-0602-9.

    Article  CAS  PubMed  Google Scholar 

  68. Kreuzberg MM, Liebermann M, Segschneider S, et al. Human connexin31.9, unlike its orthologous protein connexin30.2 in the mouse, is not detectable in the human cardiac conduction system. J Mol Cell Cardiol. 2009;46(4):553–9. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.yjmcc.2008.12.007.

    Article  CAS  PubMed  Google Scholar 

  69. Myers JB, Haddad BG, O’Neill SE, et al. Structure of native lens connexin 46/50 intercellular channels by cryo-EM. Nature. 2018;564(7736):372–7. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41586-018-0786-7.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  70. LeMasurier M, Gillespie PG. Hair-cell mechanotransduction and cochlear amplification. Neuron. 2005;48(3):403–15. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.neuron.2005.10.017.

    Article  CAS  PubMed  Google Scholar 

  71. Hakizimana P, Fridberger A. Inner hair cell stereocilia are embedded in the tectorial membrane. Nat Commun. 2021;12:2604. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41467-021-22870-1.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  72. Anselmi F, Hernandez VH, Crispino G, et al. ATP release through connexin hemichannels and gap junction transfer of second messengers propagate Ca2+ signals across the inner ear. Proc Natl Acad Sci U S A. 2008;105(48):18770–5. https://doiorg.publicaciones.saludcastillayleon.es/10.1073/pnas.0800793105.

    Article  PubMed  PubMed Central  Google Scholar 

  73. Wangemann P. K+ cycling and the endocochlear potential. Hear Res. 2002;165(1):1–9. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/S0378-5955(02)00279-4.

    Article  CAS  PubMed  Google Scholar 

  74. Anniko M, Wróblewski R. Ionic environment of cochlear hair cells. Hear Res. 1986;22(1):279–93. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/0378-5955(86)90104-8.

    Article  CAS  PubMed  Google Scholar 

  75. Forge A, Becker D, Casalotti S, Edwards J, Marziano N, Nevill G. Gap junctions in the inner ear: comparison of distribution patterns in different vertebrates and assessement of connexin composition in mammals. J Comp Neurol. 2003;467(2):207–31. https://doiorg.publicaciones.saludcastillayleon.es/10.1002/cne.10916.

    Article  PubMed  Google Scholar 

  76. Parra-Perez AM, Lopez-Escamez JA. Types of Inheritance and Genes Associated with Familial Meniere Disease. J Assoc Res Otolaryngol JARO. Published online April 6, 2023. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s10162-023-00896-0

Download references

Acknowledgements

We would also like to recognize Dr Lidia Frejo for suggestions with immunofluorescence analysis.

Funding

JALE has received funds to support research on genetics in Meniere’s disease from The University of Sydney (K7013_B3413 Grant), Asociacion Sindrome de Meniere España (ASMES), and Meniere’s Society, UK. AGM has received funds from the Andalusian Health Department (Grant PI-0266–2021) and from CuresWithinReach and the Knight Family. JALE and AGM have received funds from the Andalusian Government (CECEU 2020, grant code: DOC_01677). IVN and SMC have received funds from PID2020-115274RB-I00 and PID2023-147347OB-I00 funded by MCIN/AEI/https://doiorg.publicaciones.saludcastillayleon.es/10.13039/501100011033, MICIU/AEI/https://doiorg.publicaciones.saludcastillayleon.es/10.13039/501100011033 and FEDER, UE; and COST Action CA20113 PROTEOCURE. AMPP was supported by a PhD scholarship from the Regional Ministry of Economic Transformation, Industry, Knowledge and Universities of Junta de Andalucía (Grant number PREDOC2021/00343).

Author information

Authors and Affiliations

  1. Otology & Neurotology Group CTS495, Instituto de Investigación Biosanitario, Ibs.GRANADA, Universidad de Granada, 18071, Granada, Spain

    Alba Escalera-Balsera, Paula Robles-Bolivar, Alberto M. Parra-Perez, Alvaro Gallego-Martinez & Jose A. Lopez-Escamez

  2. Division of Otolaryngology, Department of Surgery, Universidad de Granada, Granada, Spain

    Alba Escalera-Balsera, Paula Robles-Bolivar, Alberto M. Parra-Perez, Alvaro Gallego-Martinez & Jose A. Lopez-Escamez

  3. Sensorineural Pathology Programme, Centro de Investigación Biomédica en Red en Enfermedades Raras, CIBERER, Madrid, Spain

    Alba Escalera-Balsera, Paula Robles-Bolivar, Alberto M. Parra-Perez, Silvia Murillo-Cuesta, Lourdes Rodríguez-de la Rosa, Julio Contreras, Isabel Varela-Nieto, Alvaro Gallego-Martinez & Jose A. Lopez-Escamez

  4. Institute for Biomedical Research Sols-Morreale (IIBm), Spanish National Research Council-Autonomous University of Madrid (CSIC-UAM), Madrid, Spain

    Silvia Murillo-Cuesta, Lourdes Rodríguez-de la Rosa & Isabel Varela-Nieto

  5. La Paz Hospital Institute for Health Research (IdiPAZ), Madrid, Spain

    Silvia Murillo-Cuesta, Lourdes Rodríguez-de la Rosa, Julio Contreras & Isabel Varela-Nieto

  6. Sydney Pharmacy School, Faculty of Medicine and Health and Charles Perkins Centre, The University of Sydney, Sydney, NSW, Australia

    Han Chow Chua

  7. Anatomy and Embryology Department, Faculty of Veterinary, Universidad Complutense de Madrid, Madrid, Spain

    Julio Contreras

  8. Department of Otorhinolaryngology, Head and Neck Surgery, Charité-Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin and Humboldt-Universität Zu Berlin, Charitéplatz 1, 10117, Berlin, Germany

    Ewa Domarecka & Agnieszka J. Szczepek

  9. Department of Otolaryngology, Hospital Can Misses, Ibiza, Spain

    Juan Carlos Amor-Dorado

  10. Health Research Institute of Santiago de Compostela (IDIS), Santiago de Compostela, Spain

    Andrés Soto-Varela

  11. Division of Otoneurology, Department of Otorhinolaryngology, Complexo Hospitalario Universitario, Santiago de Compostela, Spain

    Andrés Soto-Varela

  12. Department of Surgery and Medical-Surgical Specialities, Universidade de Santiago de Compostela, Santiago de Compostela, Spain

    Andrés Soto-Varela

  13. Faculty of Medicine & Health, School of Medical Sciences, Meniere’s Disease Neuroscience Research Program, The Kolling Institute, University of Sydney, Sydney, NSW, Australia

    Jose A. Lopez-Escamez

Authors
  1. Alba Escalera-Balsera
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Paula Robles-Bolivar
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Alberto M. Parra-Perez
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Silvia Murillo-Cuesta
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Han Chow Chua
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Lourdes Rodríguez-de la Rosa
    View author publications

    You can also search for this author inPubMed Google Scholar

  7. Julio Contreras
    View author publications

    You can also search for this author inPubMed Google Scholar

  8. Ewa Domarecka
    View author publications

    You can also search for this author inPubMed Google Scholar

  9. Juan Carlos Amor-Dorado
    View author publications

    You can also search for this author inPubMed Google Scholar

  10. Andrés Soto-Varela
    View author publications

    You can also search for this author inPubMed Google Scholar

  11. Isabel Varela-Nieto
    View author publications

    You can also search for this author inPubMed Google Scholar

  12. Agnieszka J. Szczepek
    View author publications

    You can also search for this author inPubMed Google Scholar

  13. Alvaro Gallego-Martinez
    View author publications

    You can also search for this author inPubMed Google Scholar

  14. Jose A. Lopez-Escamez
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

Conceptualization: A.E.-B. and J.A.L.-E.; methodology: A.E.-B., P.R.-B., A.M.P.-P., C.H.C., L.R.-dlR., J.C., and E.D.; software: A.E.-B., A.M.P.-P., and A.G.-M.; formal analysis: A.E.-B.; investigation: A.E.-B., S.M.-C., C.H.C., and A.G.-M.; interpretation of data: A.E.-B., P.R.-B., A.M.P.-P., S.M.-C., C.H.C., L.R.-dlR., J.C., E.D., J.C.A.-D., A.S.-V., I.V.-N., A.J.S., A.G.-M., and J.A.L.-E.; resources: J.C.A.-D., A.S.-V., I.V.-N., A.J.S., and J.A.L.-E.; data curation: A.E.-B.; writing—original draft preparation: A.E.-B. and J.A.L.-E.; writing—review and editing: A.E.-B., P.R.-B., A.M.P.-P., S.M.-C., C.H.C., L.R.-dlR., J.C., E.D., J.C.A.-D., A.S.-V., I.V.-N., A.J.S., A.G.-M., and J.A.L.-E.; visualization: A.E.-B., P.R.-B., and A.M.P.-P.; supervision: I.V.-N., A.J.S., A.G.-M., and J.A.L.-E.; project administration: J.A.L.-E.; funding acquisition: J.A.L.-E. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Jose A. Lopez-Escamez.

Ethics declarations

Ethics approval and consent to participate

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Granada Ethical Review Board for Clinical Research under the protocol number 1805-N-20. Written informed consent has been obtained from the patients to publish de-identified clinical data. The Governmental Ethics Commission for Animal Welfare in Berlin under the approval number T 0235/18; and by the Dirección General de Agricultura, Ganadería y Alimentación in Comunidad de Madrid under the approval number PROEX 325.4/21.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1: Supplementary methods, figures and tables.

13073_2024_1425_MOESM2_ESM.vcf

Additional file 2: VCF file containing the variants in the connexin genes from the individuals participating in the study.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Escalera-Balsera, A., Robles-Bolivar, P., Parra-Perez, A.M. et al. A rare haplotype of the GJD3 gene segregating in familial Meniere’s disease interferes with connexin assembly. Genome Med 17, 4 (2025). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13073-024-01425-1

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13073-024-01425-1

Keywords

Genome Medicine

ISSN: 1756-994X

Contact us